amp r Search Results


90
Promega amp r lacz
Strains and plasmids used in this study
Amp R Lacz, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/amp+r+lacz/pmc00134800-4-2-9
Average 90 stars, based on 1 article reviews
amp r lacz - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega amp solution
Strains and plasmids used in this study
Amp Solution, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/amp+r/pm34592582-82-16-18
Average 90 stars, based on 1 article reviews
amp solution - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega amp r lacz reporter
Strains and plasmids used in this study
Amp R Lacz Reporter, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/amp+r+lacz+reporter/pmc07398562-0-5-10
Average 90 stars, based on 1 article reviews
amp r lacz reporter - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Becton Dickinson amp r p adh1 :: gal4 minc ec (g161s
Strains and plasmids used in this study
Amp R P Adh1 / Gal4 Minc Ec (G161s, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/amp+r+p+adh1++++gal4+minc+ec++g161s/pmc00387809-41-7-8
Average 90 stars, based on 1 article reviews
amp r p adh1 :: gal4 minc ec (g161s - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega f1 amp r lacz-α
Bacterial strains and plasmids used in this study
F1 Amp R Lacz α, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/f1+amp+r+lacz+%CE%B1/pmc08265659-19-5-10
Average 90 stars, based on 1 article reviews
f1 amp r lacz-α - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pgemt-easy pcr cloning vector, amp r
Bacterial plasmids and strains used in this study
Pgemt Easy Pcr Cloning Vector, Amp R, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pgemt+easy+pcr+cloning+vector++amp+r/pmc00165992-180-35-37
Average 90 stars, based on 1 article reviews
pgemt-easy pcr cloning vector, amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pcr generated dna fragment cloning vector amp r
<t>PCR</t> amplification using oligonucleotides pair F1 eptC -R1 eptC and <t>DNA</t> template from P. mirabilis strains R110 (Lane 2), 50/57 (Lane 3), 51/57 (Lane 4), and TG83 (Lane 5). Lane 1, molecular weight standard.
Pcr Generated Dna Fragment Cloning Vector Amp R, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pcr+generated+dna+fragment+cloning+vector+amp+r/pmc04013655-19-3-12
Average 90 stars, based on 1 article reviews
pcr generated dna fragment cloning vector amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pgem-t cloning vector, amp r
(A) Diagrammatic representation of the locus containing the nrrF gene in MC58. The Fur-regulated promoter is indicated in gray, the orientation of the sRNA is indicated with a black arrow, and the relative position of the rho-independent transcriptional terminator is marked with a hairpin loop. (B) Mapping of the 5′ end of the nrrF transcript by primer extension. Portions (20 μg) of total RNA prepared from cultures of the wild type (MC58) and Fur-null mutant (MC-Fko) grown to mid-logarithmic phase under iron-replete conditions were hybridized with the sR-p7 primer (Table ​(Table1)1) and elongated with reverse transcriptase. The elongated primer band mapping the 5′ end of the sRNA transcript is indicated. Sequence reactions (G, A, T, and C) were performed with the same primer on plasmid <t>pGemsRNA1/2</t> as a template. The corresponding +1 nucleotide of transcriptional initiation and the upstream promoter sequences are indicated on the left. (C) DNase I footprinting analysis with purified meningococcal Fur protein and a radioactively labeled 245-bp DNA probe, 5′ end labeled at the EcoRI site, corresponding to the nrrF promoter region. The probe was incubated with increasing concentrations of Fur protein: lanes 1 to 6 correspond to concentrations of 0, 14 nM, 44 nM, 130 nM, 392 nM, and 1.2 μM concentrations of Fur protein. A G+A sequencing reaction (19) of the probe was performed and run in parallel as a molecular weight ladder. The box and arrow to the left show the position and the direction of the Fur-box and nrrF gene, respectively. The Fur-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries of the binding site with respect to the +1 transcriptional initiation site. (D) Regulation of NrrF transcription. Total RNA was prepared from the wild type (MC58), the Fur-null mutant (MC-Fko), its complemented derivative (MC-Fko-C), the Hfq mutant (Δhfq), and the Fur and Hfq double mutant (Fko-Δhfq) grown to mid-log phase under iron-replete conditions before (+) and after (−) 15 min of treatment with iron chelator (2,2′-dipyridyl). Then, 10 μg of RNA from each strain was reverse transcribed with the sR-p7 primer, and the relative quantities of extended primer product are shown from a single representative experiment. (E) Time course experiment in which cultures of MC58 and MC-Fko strains were grown in iron-replete conditions and total RNA was extracted after 1, 2, and 3 h (logarithmic phase) and 5 and 7 h (stationary phase). The relative quantities of NrrF and tbp2 transcripts were analyzed from 10 μg of each total RNA sample by quantitative primer extension and S1 nuclease assay, respectively.
Pgem T Cloning Vector, Amp R, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pgem+t+cloning+vector++amp+r/pmc02631994-343-161-163
Average 90 stars, based on 1 article reviews
pgem-t cloning vector, amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
IBA GmbH expression plasmid containing a tetracycline inducible promoter; amp r
(A) Diagrammatic representation of the locus containing the nrrF gene in MC58. The Fur-regulated promoter is indicated in gray, the orientation of the sRNA is indicated with a black arrow, and the relative position of the rho-independent transcriptional terminator is marked with a hairpin loop. (B) Mapping of the 5′ end of the nrrF transcript by primer extension. Portions (20 μg) of total RNA prepared from cultures of the wild type (MC58) and Fur-null mutant (MC-Fko) grown to mid-logarithmic phase under iron-replete conditions were hybridized with the sR-p7 primer (Table ​(Table1)1) and elongated with reverse transcriptase. The elongated primer band mapping the 5′ end of the sRNA transcript is indicated. Sequence reactions (G, A, T, and C) were performed with the same primer on plasmid <t>pGemsRNA1/2</t> as a template. The corresponding +1 nucleotide of transcriptional initiation and the upstream promoter sequences are indicated on the left. (C) DNase I footprinting analysis with purified meningococcal Fur protein and a radioactively labeled 245-bp DNA probe, 5′ end labeled at the EcoRI site, corresponding to the nrrF promoter region. The probe was incubated with increasing concentrations of Fur protein: lanes 1 to 6 correspond to concentrations of 0, 14 nM, 44 nM, 130 nM, 392 nM, and 1.2 μM concentrations of Fur protein. A G+A sequencing reaction (19) of the probe was performed and run in parallel as a molecular weight ladder. The box and arrow to the left show the position and the direction of the Fur-box and nrrF gene, respectively. The Fur-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries of the binding site with respect to the +1 transcriptional initiation site. (D) Regulation of NrrF transcription. Total RNA was prepared from the wild type (MC58), the Fur-null mutant (MC-Fko), its complemented derivative (MC-Fko-C), the Hfq mutant (Δhfq), and the Fur and Hfq double mutant (Fko-Δhfq) grown to mid-log phase under iron-replete conditions before (+) and after (−) 15 min of treatment with iron chelator (2,2′-dipyridyl). Then, 10 μg of RNA from each strain was reverse transcribed with the sR-p7 primer, and the relative quantities of extended primer product are shown from a single representative experiment. (E) Time course experiment in which cultures of MC58 and MC-Fko strains were grown in iron-replete conditions and total RNA was extracted after 1, 2, and 3 h (logarithmic phase) and 5 and 7 h (stationary phase). The relative quantities of NrrF and tbp2 transcripts were analyzed from 10 μg of each total RNA sample by quantitative primer extension and S1 nuclease assay, respectively.
Expression Plasmid Containing A Tetracycline Inducible Promoter; Amp R, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/expression+plasmid+containing+a+tetracycline+inducible+promoter++amp+r/pmc03625468-12-9-12
Average 90 stars, based on 1 article reviews
expression plasmid containing a tetracycline inducible promoter; amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pgem-t pcr product cloning vector; amp r
Bacterial strains and plasmids used in this study
Pgem T Pcr Product Cloning Vector; Amp R, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pgem+t+pcr+product+cloning+vector++amp+r/pmc00095528-52-107-109
Average 90 stars, based on 1 article reviews
pgem-t pcr product cloning vector; amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pgem-t amp r , t7 rna polymerase promoter, t-cloning vector
E. coli strains and plasmids used in this study
Pgem T Amp R , T7 Rna Polymerase Promoter, T Cloning Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pgem+t+amp+r+++t7+rna+polymerase+promoter++t+cloning+vector/pmc00111273-125-119-121
Average 90 stars, based on 1 article reviews
pgem-t amp r , t7 rna polymerase promoter, t-cloning vector - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega pgem-t , 3.0-kb vector for pcr product cloning; amp r
Strains and plasmids used in this study
Pgem T , 3.0 Kb Vector For Pcr Product Cloning; Amp R, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/amp+r/pgem+t+++3+0+kb+vector+for+pcr+product+cloning++amp+r/pmc02446746-7-0-11
Average 90 stars, based on 1 article reviews
pgem-t , 3.0-kb vector for pcr product cloning; amp r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Strains and plasmids used in this study

Journal:

Article Title: ccfA , the Genetic Determinant for the cCF10 Peptide Pheromone in Enterococcus faecalis OG1RF

doi: 10.1128/jb.184.4.1155-1162.2002

Figure Lengend Snippet: Strains and plasmids used in this study

Article Snippet: pGEM-T-Easy , Amp r lacZ , cloning vector , Promega.

Techniques: Plasmid Preparation, Clone Assay, Produced, Mutagenesis

Strains and plasmids used in this study

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Strains and plasmids used in this study

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Plasmid Preparation

Oligonucleotide primers used for PCRs in this study

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Oligonucleotide primers used for PCRs in this study

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Sequencing

Summary of functionality of  MinC  Ng ,  MinC  Ec , and MinCh mutants

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Summary of functionality of MinC Ng , MinC Ec , and MinCh mutants

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Mutagenesis, Over Expression

Flow cytometry analysis of E. coli PB103 cells overexpressing MinCEc and MinCNg mutant proteins. (A and B) Flow cytometry dot plots of E. coli populations transformed with pSR2 (wild-type MinCNg) as a positive control (A) and with pUC18 as a negative control (B). The plots of side scatter (SS) versus forward scatter (FS) show two population sizes, the wild-type rods within gate A and long filaments within gate B. The percentages of cells are expressed as percentages of the gated events. (C) Graph showing the percentages of filamentation in a population of 100,000 cells expressing wild-type (WT) MinCEc and MinCNg proteins, as well as MinCEc mutants G135D, G154D, G161S, G171E, and P141A and MinCNg mutants G138D, G157D, G164S, G174E, and E144I. An unpaired t test analysis showed that the differences in the percentage of filamentation between wild-type MinCNg and MinCNg E144I and between wild-type MinCEc and MinCEc P141A were not significant (P = 0.063 and P = 0.097, respectively). The error bars indicate standard errors.

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Flow cytometry analysis of E. coli PB103 cells overexpressing MinCEc and MinCNg mutant proteins. (A and B) Flow cytometry dot plots of E. coli populations transformed with pSR2 (wild-type MinCNg) as a positive control (A) and with pUC18 as a negative control (B). The plots of side scatter (SS) versus forward scatter (FS) show two population sizes, the wild-type rods within gate A and long filaments within gate B. The percentages of cells are expressed as percentages of the gated events. (C) Graph showing the percentages of filamentation in a population of 100,000 cells expressing wild-type (WT) MinCEc and MinCNg proteins, as well as MinCEc mutants G135D, G154D, G161S, G171E, and P141A and MinCNg mutants G138D, G157D, G164S, G174E, and E144I. An unpaired t test analysis showed that the differences in the percentage of filamentation between wild-type MinCNg and MinCNg E144I and between wild-type MinCEc and MinCEc P141A were not significant (P = 0.063 and P = 0.097, respectively). The error bars indicate standard errors.

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Flow Cytometry, Mutagenesis, Transformation Assay, Positive Control, Negative Control, Expressing

Expression of MinC mutant proteins in E. coli PB103: Western blots obtained with anti-MinCNg. (A) E. coli PB103 was transformed with pUC18 (control) (lane 1), pSR32 (wild-type minCEc control) (lane 2), pSR32G135 (minCEc encoding the G135D mutation) (lane 3), pSR32G154 (minCEc encoding the G154D mutation) (lane 4), pSR32G161 (minCEc encoding the G161S mutation) (lane 5), pSR32G171 (minCEc encoding the G171E mutation) (lane 6), and pSR32P141 (minCEc encoding the P141A mutation) (lane 7). (B) E. coli PB103 was transformed with pUC18 (control) (lane 1), pSR2 (wild-type minCNg control) (lane 2), pVG4 (minCNg encoding the G138D mutation) (lane 3), pVG6 (minCNg encoding the G157D mutation) (lane 4), pVG8 (minCNg encoding the G164S mutation) (lane 5), pVG10 (minCNg encoding the G174E mutation) (lane 6), and pPF1 (minCNg encoding the E144I mutation) (lane 7).

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Expression of MinC mutant proteins in E. coli PB103: Western blots obtained with anti-MinCNg. (A) E. coli PB103 was transformed with pUC18 (control) (lane 1), pSR32 (wild-type minCEc control) (lane 2), pSR32G135 (minCEc encoding the G135D mutation) (lane 3), pSR32G154 (minCEc encoding the G154D mutation) (lane 4), pSR32G161 (minCEc encoding the G161S mutation) (lane 5), pSR32G171 (minCEc encoding the G171E mutation) (lane 6), and pSR32P141 (minCEc encoding the P141A mutation) (lane 7). (B) E. coli PB103 was transformed with pUC18 (control) (lane 1), pSR2 (wild-type minCNg control) (lane 2), pVG4 (minCNg encoding the G138D mutation) (lane 3), pVG6 (minCNg encoding the G157D mutation) (lane 4), pVG8 (minCNg encoding the G164S mutation) (lane 5), pVG10 (minCNg encoding the G174E mutation) (lane 6), and pPF1 (minCNg encoding the E144I mutation) (lane 7).

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Expressing, Mutagenesis, Western Blot, Transformation Assay

Protein-protein interactions of MinCEc mutant proteins. The graph shows the interactions of wild-type (WT) and mutant E. coli MinC proteins (G135D, G154D, G161S, G171E, and P141A) with themselves (open bars) and with MinDEc (grey bars). An unpaired t test analysis showed that the differences in the strengths of self-interaction between wild-type MinCEc and the G135D, G154D, and P141A mutants were not significant (P = 0.128, P = 0.07, and P = 0.153, respectively). However, the difference in the strength of the self-interaction between wild-type MinCEc and the G171E mutant was significant (P = 0.005). The difference in the strength of the interaction between wild-type MinCEc or MinCEc G161S and MinDEc was significant (P = 0.005), whereas the interaction between the MinCEc P141A mutant and MinDEc was not significantly different (P = 0.091). The error bars indicate standard errors.

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Protein-protein interactions of MinCEc mutant proteins. The graph shows the interactions of wild-type (WT) and mutant E. coli MinC proteins (G135D, G154D, G161S, G171E, and P141A) with themselves (open bars) and with MinDEc (grey bars). An unpaired t test analysis showed that the differences in the strengths of self-interaction between wild-type MinCEc and the G135D, G154D, and P141A mutants were not significant (P = 0.128, P = 0.07, and P = 0.153, respectively). However, the difference in the strength of the self-interaction between wild-type MinCEc and the G171E mutant was significant (P = 0.005). The difference in the strength of the interaction between wild-type MinCEc or MinCEc G161S and MinDEc was significant (P = 0.005), whereas the interaction between the MinCEc P141A mutant and MinDEc was not significantly different (P = 0.091). The error bars indicate standard errors.

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Mutagenesis

Protein-protein interactions of MinCNg mutants. The graph shows the interactions of wild-type MinCNg and MinCCh with themselves and with MinDNg and the interactions of mutant MinCCh proteins with MinDNg. An unpaired t test analysis showed that the differences in the strengths of the interactions of wild-type MinCCh and mutant MinCCh G161S with MinDNg were significant (P = 0.000), while the interaction of the MinCCh E141I mutant with MinDNg was not significant (P = 0.155). The error bars indicate standard errors.

Journal:

Article Title: Conserved Glycines in the C Terminus of MinC Proteins Are Implicated in Their Functionality as Cell Division Inhibitors

doi: 10.1128/JB.186.9.2841-2855.2004

Figure Lengend Snippet: Protein-protein interactions of MinCNg mutants. The graph shows the interactions of wild-type MinCNg and MinCCh with themselves and with MinDNg and the interactions of mutant MinCCh proteins with MinDNg. An unpaired t test analysis showed that the differences in the strengths of the interactions of wild-type MinCCh and mutant MinCCh G161S with MinDNg were significant (P = 0.000), while the interaction of the MinCCh E141I mutant with MinDNg was not significant (P = 0.155). The error bars indicate standard errors.

Article Snippet: pSRBD-G161 , Amp r P ADH1 :: gal4 (BD)- minC Ec (G161S) , This study.

Techniques: Mutagenesis

Bacterial strains and plasmids used in this study

Journal: mSphere

Article Title: A PorX/PorY and σ P Feedforward Regulatory Loop Controls Gene Expression Essential for Porphyromonas gingivalis Virulence

doi: 10.1128/mSphere.00428-21

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: pGEM-T-Easy , rep pMB1 , f1 Amp R lacZ-α , Promega.

Techniques: Plasmid Preparation

Bacterial plasmids and strains used in this study

Journal:

Article Title: Critical Role of Multidrug Efflux Pump CmeABC in Bile Resistance and In Vivo Colonization of Campylobacter jejuni

doi: 10.1128/IAI.71.8.4250-4259.2003

Figure Lengend Snippet: Bacterial plasmids and strains used in this study

Article Snippet: When needed, culture media were supplemented with kanamycin (30 μg/ml) or chloramphenicol (20 μg/ml). table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Plasmid or strain Description Source or reference Plasmids pGEMT-Easy PCR cloning vector, Amp r Promega pCMEC pGEMT-Easy containing 1.5-kb cmeC fragment, Amp r This study pCMECK pCMEC with kanamycin resistance cassette inserted in cmeC gene, Amp r Kan r This study pUOA18 E. coli-C. jejuni shuttle vector, Cm r 49 pCME pUOA18 derivative containing a wild-type cmeABC operon This study Strains C. jejuni 81-176 Wild type; isolated from human 7 21190 Wild type; isolated from chicken 25 JL101 21190 derivative; cmeB :: kan 28 JL102 21190 derivative; cmeC :: kan This study JL103 JL101/pCME, Kan r Cm r This study JL104 JL102/pCME, Kan r Cm r This study E. coli JM109 endA1 recA1 gyrA96 thi hsdR17 (r k − m k + ) relA1 supE44 Δ( lac-proAB ) [F′ traD36 lac I q Z ΔM15] Promega Open in a separate window Bacterial plasmids and strains used in this study

Techniques: PCR Cloning, Plasmid Preparation, Isolation

PCR amplification using oligonucleotides pair F1 eptC -R1 eptC and DNA template from P. mirabilis strains R110 (Lane 2), 50/57 (Lane 3), 51/57 (Lane 4), and TG83 (Lane 5). Lane 1, molecular weight standard.

Journal: International Journal of Molecular Sciences

Article Title: Functional Identification of Proteus mirabilis eptC Gene Encoding a Core Lipopolysaccharide Phosphoethanolamine Transferase

doi: 10.3390/ijms15046689

Figure Lengend Snippet: PCR amplification using oligonucleotides pair F1 eptC -R1 eptC and DNA template from P. mirabilis strains R110 (Lane 2), 50/57 (Lane 3), 51/57 (Lane 4), and TG83 (Lane 5). Lane 1, molecular weight standard.

Article Snippet: pGEMT easy , PCR generated DNA fragment cloning vector Amp R , Promega .

Techniques: Amplification, Molecular Weight

Bacterial strains and plasmids used.

Journal: International Journal of Molecular Sciences

Article Title: Functional Identification of Proteus mirabilis eptC Gene Encoding a Core Lipopolysaccharide Phosphoethanolamine Transferase

doi: 10.3390/ijms15046689

Figure Lengend Snippet: Bacterial strains and plasmids used.

Article Snippet: pGEMT easy , PCR generated DNA fragment cloning vector Amp R , Promega .

Techniques: Plasmid Preparation, Mutagenesis, Generated, Clone Assay, Expressing

(A) Diagrammatic representation of the locus containing the nrrF gene in MC58. The Fur-regulated promoter is indicated in gray, the orientation of the sRNA is indicated with a black arrow, and the relative position of the rho-independent transcriptional terminator is marked with a hairpin loop. (B) Mapping of the 5′ end of the nrrF transcript by primer extension. Portions (20 μg) of total RNA prepared from cultures of the wild type (MC58) and Fur-null mutant (MC-Fko) grown to mid-logarithmic phase under iron-replete conditions were hybridized with the sR-p7 primer (Table ​(Table1)1) and elongated with reverse transcriptase. The elongated primer band mapping the 5′ end of the sRNA transcript is indicated. Sequence reactions (G, A, T, and C) were performed with the same primer on plasmid pGemsRNA1/2 as a template. The corresponding +1 nucleotide of transcriptional initiation and the upstream promoter sequences are indicated on the left. (C) DNase I footprinting analysis with purified meningococcal Fur protein and a radioactively labeled 245-bp DNA probe, 5′ end labeled at the EcoRI site, corresponding to the nrrF promoter region. The probe was incubated with increasing concentrations of Fur protein: lanes 1 to 6 correspond to concentrations of 0, 14 nM, 44 nM, 130 nM, 392 nM, and 1.2 μM concentrations of Fur protein. A G+A sequencing reaction (19) of the probe was performed and run in parallel as a molecular weight ladder. The box and arrow to the left show the position and the direction of the Fur-box and nrrF gene, respectively. The Fur-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries of the binding site with respect to the +1 transcriptional initiation site. (D) Regulation of NrrF transcription. Total RNA was prepared from the wild type (MC58), the Fur-null mutant (MC-Fko), its complemented derivative (MC-Fko-C), the Hfq mutant (Δhfq), and the Fur and Hfq double mutant (Fko-Δhfq) grown to mid-log phase under iron-replete conditions before (+) and after (−) 15 min of treatment with iron chelator (2,2′-dipyridyl). Then, 10 μg of RNA from each strain was reverse transcribed with the sR-p7 primer, and the relative quantities of extended primer product are shown from a single representative experiment. (E) Time course experiment in which cultures of MC58 and MC-Fko strains were grown in iron-replete conditions and total RNA was extracted after 1, 2, and 3 h (logarithmic phase) and 5 and 7 h (stationary phase). The relative quantities of NrrF and tbp2 transcripts were analyzed from 10 μg of each total RNA sample by quantitative primer extension and S1 nuclease assay, respectively.

Journal:

Article Title: The Hfq-Dependent Small Noncoding RNA NrrF Directly Mediates Fur-Dependent Positive Regulation of Succinate Dehydrogenase in Neisseria meningitidis

doi: 10.1128/JB.00849-08

Figure Lengend Snippet: (A) Diagrammatic representation of the locus containing the nrrF gene in MC58. The Fur-regulated promoter is indicated in gray, the orientation of the sRNA is indicated with a black arrow, and the relative position of the rho-independent transcriptional terminator is marked with a hairpin loop. (B) Mapping of the 5′ end of the nrrF transcript by primer extension. Portions (20 μg) of total RNA prepared from cultures of the wild type (MC58) and Fur-null mutant (MC-Fko) grown to mid-logarithmic phase under iron-replete conditions were hybridized with the sR-p7 primer (Table ​(Table1)1) and elongated with reverse transcriptase. The elongated primer band mapping the 5′ end of the sRNA transcript is indicated. Sequence reactions (G, A, T, and C) were performed with the same primer on plasmid pGemsRNA1/2 as a template. The corresponding +1 nucleotide of transcriptional initiation and the upstream promoter sequences are indicated on the left. (C) DNase I footprinting analysis with purified meningococcal Fur protein and a radioactively labeled 245-bp DNA probe, 5′ end labeled at the EcoRI site, corresponding to the nrrF promoter region. The probe was incubated with increasing concentrations of Fur protein: lanes 1 to 6 correspond to concentrations of 0, 14 nM, 44 nM, 130 nM, 392 nM, and 1.2 μM concentrations of Fur protein. A G+A sequencing reaction (19) of the probe was performed and run in parallel as a molecular weight ladder. The box and arrow to the left show the position and the direction of the Fur-box and nrrF gene, respectively. The Fur-protected region is indicated to the right as a vertical black bar, and the numbers indicate the boundaries of the binding site with respect to the +1 transcriptional initiation site. (D) Regulation of NrrF transcription. Total RNA was prepared from the wild type (MC58), the Fur-null mutant (MC-Fko), its complemented derivative (MC-Fko-C), the Hfq mutant (Δhfq), and the Fur and Hfq double mutant (Fko-Δhfq) grown to mid-log phase under iron-replete conditions before (+) and after (−) 15 min of treatment with iron chelator (2,2′-dipyridyl). Then, 10 μg of RNA from each strain was reverse transcribed with the sR-p7 primer, and the relative quantities of extended primer product are shown from a single representative experiment. (E) Time course experiment in which cultures of MC58 and MC-Fko strains were grown in iron-replete conditions and total RNA was extracted after 1, 2, and 3 h (logarithmic phase) and 5 and 7 h (stationary phase). The relative quantities of NrrF and tbp2 transcripts were analyzed from 10 μg of each total RNA sample by quantitative primer extension and S1 nuclease assay, respectively.

Article Snippet: In order to study the implications of this sRNA in Fur-mediated regulation, we selected the sdhCDAB operon as a probable target for the sRNA and selected sodB for the detailed analysis of Fur-mediated positive regulation. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain or plasmid Relevant characteristics a Source or reference Strains N. meningitidis MC58 Clinical isolate, sequenced strain 35 MC-Fko Fur-null mutant derivative of MC58, Km r 5 MC-Fko-C Complemented Fur mutant, Km r Cm r 5 Δ hfq Hfq-null mutant of MC58, Cm r This study Fko-Δ hfq Fur and Hfq double mutant of MC58, Km r Cm r This study MC-sRN2 NrrF null of MC58, Ery r This study Fko-sRN2 Fur and NrrF double mutant of MC58, Km r Ery r This study E. coli DH5-α supE44 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 13 BL21(DE3) hsdS gal (λ c I ts 857 ind1 S am7 nin-5 lac UV5-T7 gene 1 ) 33 Plasmids pGEM-T Cloning vector, Amp r Promega pGEMsrna1/2 pGEM-T derivative containing the promoter of the nrrF gene amplified with primers sRNA1 and sRNA2 This study pGem-SDH pGEM-T derivative containing the promoter of the succinate dehydrogenase operon amplified with the primers SDH-1 and SDH-2 This study psRN2ko:Erm Construct for generating knockout of the nrrF gene This study pΔhfqko:Cm Construct for generating knockout of the hfq gene This study pET15b Expression vector for N-terminal His-tagged proteins Invitrogen pET15hfq pET15b derivative containing the hfq gene amplified from the MC58 genome with primers Hfq-F/Hfq-R and cloned as an NdeI-XhoI fragment for expression of recombinant Hfq protein This study pGemSOD pGEM-T derivative containing promoter of the sodB gene amplified with the primers sod-1 and sod-2 This study pGemSdA pGEMT- derivative containing a cloned region of the sdhA gene, spanning from positions 64 to 267 with respect to the ATG start site, amplified with the primers sdA-F and sdA-R This study Open in a separate window a Cm r , chloramphenicol resistance; Amp r , ampicillin resistance; Ery r , erythromycin resistance; Km r , kanamycin resistance.

Techniques: Mutagenesis, Sequencing, Plasmid Preparation, Footprinting, Purification, Labeling, Incubation, Molecular Weight, Binding Assay, Nuclease Assay

Bacterial strains and plasmids used in this study

Journal:

Article Title: Noncoupled NADH:Ubiquinone Oxidoreductase of Azotobacter vinelandii Is Required for Diazotrophic Growth at High Oxygen Concentrations

doi: 10.1128/JB.183.23.6869-6874.2001

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: E. coli cells were routinely grown in Luria-Bertani (LB) medium. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strains and plasmids Characteristic(s) Reference or source A. vinelandii UW136 Rif r 15 A. vinelandii MK8 UW136 cydR ::Tn 5 Rif r Km r 15 A. vinelandii DN165 UW136 ndh ::ΩTc Rif r Tc r This work A. vinelandii N24 UW136 ndh ::pNDT6 Rif r Tc r Amp r This work E. coli TG1 F′ traD36 lacI q Z ΔM15 proAB + / supE Δ( hsdM - mcrB ) 5 (r K − m K + msrB ) thi Δ( lac-pro AB) Promega pGEM-T PCR product cloning vector; Amp r Promega pHP45ΩTc Tetracycline resistance 9 pND7 pGEM-T with 400-bp fragment of A. vinelandii ndh ; Amp r This work pNDT6 pND7 with ΩTc inserted in Sma I site of ndh fragment; Amp r Tc r This work Open in a separate window Bacterial strains and plasmids used in this study K Lα .

Techniques: Clone Assay, Plasmid Preparation

E. coli strains and plasmids used in this study

Journal:

Article Title: A Second [2Fe-2S] Ferredoxin from Sphingomonas sp. Strain RW1 Can Function as an Electron Donor for the Dioxin Dioxygenase

doi:

Figure Lengend Snippet: E. coli strains and plasmids used in this study

Article Snippet: The bacterial strains, plasmids, and oligonucleotides used in this study are listed in Table and . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype or characteristics Source or reference Strains BL21(DE3) F − ompT [ lon ] hsdS B (r B − m B − ; an E. coli B strain) with DE3 prophage Novagen DH5α F − endA1 hsdR17 (r K − m K + ) supE44 thi-1 λ − recA1 gyrA96 relA1 Δ( argF-lacZYA ) U169 φ80d lacZ ΔM15 Gibco BRL Plasmids pBluescript II KS Amp r lac′IPOZ′ , expression vector Stratagene pET9a Km r , T7 RNA polymerase promoter, expression vector Novagen pGEM-T Amp r , T7 RNA polymerase promoter, T-cloning vector Promega pAJ104 Km r , expression vector derived from pET9a encompassing fdx1 4 pAJ108 Tc r , cosmid vector derived from pLARF3 encompassing redA2 5 pAJ111 Km r , expression vector derived from pET9a encompassing redA2 5 pAJ114 Tc r , cosmid vector derived from pLARF3 encompassing fdx3 2 pAJ127 Km r , expression vector derived from pBBR1-MCS encompassing dxnA1A2 2 pAJ128 1.29-kb redA2 Eco RI- Not I PCR-amplified fragment into pGEM-T 2 pAJ129 0.33-kb fdx1 Not I- Bam HI PCR-amplified fragment into pGEM-T 2 pAJ130 Inserts from pAJ129 and pAJ128 cloned into pBluescript 2 pAJ146 0.34-kb fdx3 Nde I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ147 0.33-kb fdx3 Nde I- Bam HI fragment from pAJ146 cloned into pET9a This study pAJ148 0.56-kb fdx3 Not I- Bam HI PCR-amplified fragment into pGEM-T This study pAJ149 Inserts from pAJ148 and pAJ128 cloned into pBluescript This study Open in a separate window E. coli strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Oligonucleotide Primer sequence a Hybridization region AJ286 cggg catATG CCCAAAGTAATTTATG 5′ end of fdx3 Nde I AJ287 gcgc ggatcc GTTCAATCAAGATTGTTG 3′ end of fdx3 Bam HI AJ316 cccc ggatcc atgat gcggccGC CAGATTCTAGACCGGGATCAG 3′ end of redA2 Bam HI Not I AJ317 cgcg gaaTTC TGGAAGAGAAGGAAAG 5′ end of redA2 Eco RI AJ320 ccgg gcggccGC TCAATCTGATGCACCA 5′ end of fdx3 Not I AJ321 cgcc ggaTCC CATTAGAGATTACATCT 3′ end of fdx3 Bam HI Open in a separate window a Relevant recognition sequences for the restriction enzymes are underlined, and lowercase characters indicate the nonhomologous sequences to the corresponding DNA region from Sphingomonas sp. strain RW1.

Techniques: Plasmid Preparation, Expressing, Derivative Assay, Clone Assay

Strains and plasmids used in this study

Journal:

Article Title: Genetic and Biochemical Characterization of the Poly(3-Hydroxybutyrate- co -3-Hydroxyvalerate) Synthase in Haloferax mediterranei

doi: 10.1128/JB.00134-08

Figure Lengend Snippet: Strains and plasmids used in this study

Article Snippet: pGEM-T , 3.0-kb vector for PCR product cloning; Amp r , Promega.

Techniques: Plasmid Preparation, Mutagenesis, Clone Assay, Knock-Out